coded poetry
the majority of textual communication in the net is no longer written and read by humans but rather by machines. communication protocols like http send texts generated by programs to other programs that receive and interpret this written information. additionally algorithms curate and summarize the vast amount of postings that users write on social media platforms like facebook. googles crawlerbots scan the textual information on websites permanently, summarize it and try to make sense to create their best selling product: their search engine.
i use the very same algorithms that multinational corporations and intelligence agencies employ in the project "coded poetry" to generate minimalistic texts:
encoded, decoded, programmed poetry or codes interpreted as abstract poetry. spoken by computer voices.
work in progress...
start letters
words with their total rhymes.
english:
german:
portmanteau
the computer calculates portmanteau-words (a portmanteau is a combination of two or more words and their meanings into a single new word) by searching the dictionary.
english:
german:
Suggestion For The Next Few Weeks / vorschlag für die zukunft
a semi-automatically generated text created by using the word suggestion function of iOS 8.
english:
german:
univers declar of human right / allgemein erklar menschenrecht
every word of the "Universal Declaration of Human Rights" in german and english is reduced by a stemming algorithm to its word stem (its root, its radix). then all stop words (words that get removed in data-mining in order to better index texts) are removed. this is the way indexing algorithms (like google's search engine) read texts.
english:
german:
me you
an automatically generated minimalistic drama in english and german.
english:
german:
occupations
a search in an english word list produced a list of subjects and verbs:
Abators abate. Abbreviators abbreviate. Abdicators abdicate. Aberrators aberrate. Ablators ablate. Abnegators abnegate. Abominators abominate. Abrogators abrogate. Accelerators accelerate. Accentuators accentuate...
chromosome one
the human genome. chromosome one (excerpt). a readymade sound poem.
GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA
TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT
GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG
CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG
GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA
...
all digrams
all digrams (sequences of two characters) and single characters i found in a german word list. the word list also includes some non-german words so there are some non-german digrams in the list.
read by the computer as if it was one word.
weierstrass 1
a set of nonsense syllables generated by a weierstrass function and recited by a computer voice. infinite computer dada.
spellchecker poems
poems generated through automatic spelling suggestion (spoken by the computer). a start word was used to create 15 similar words. those words were then used to again create 15 similar words each. the resulting 15x15 words were read by a computer voice. the pieces are called like the start word (“igel“ is in german).
stine
four fast computer speech layers reciting fibonacci syllable sequences.
was wer wie weiss
a permutational chant. the sequence, speech and video is completely computer generated.
the program that generated the text was written in prolog. then spoken by the computer and tagged by automatic speech recognition to create the timed script for the video.